1. autoreconf --force --install
2. ./configure --with-url="http://meme.nbcr.net/meme"
3. autoreconf -i
4. sudo make
5. sudo make install
Learning Bioinformatics
Monday, November 17, 2014
Tuesday, May 20, 2014
Determine Transcription Factors For Genes
If you would like to find transcription factor binding sites enriched in your list of genes, try this:
DAVID for the enrichment analysis of TFBSs associated with your genes (given TFBS is involved in the control of the transcription of the gene). Once you uploaded your gene list you have an option to perform enrichment calculations using a variety of annotations. DAVID provides a category called "UCSCTFBS" in default setting this option unchecked. Please click and expand the "ProteinInteractions" and click on "UCSC_TFBS" PS. I am not sure about source of this data set, so far I got only this link the source data on DAVID forum. It will be great if someone can tell more about the data source.
If you would like to know what transcription factors (in other words, transcription factor targets) may initiate transcription of your 500 genes, try this:
I recently used "Investigate Gene Sets" options in MSigDB to find the transcription factor target information of my dataset.The data is curated from TRANSFAC, you can do a 'Compute Overlap' of your genes with the list of genes in the dataset. Output includes a p-value to indicate statistical significance and a Gene/geneset overlap matrix to visualize the gene categorized into different transcription factor targets.Transcription Factor Target Data set is available here.
Sunday, May 18, 2014
solution to R read.table does not read full table
read.table("genes.txt",sep="\t",quote="\"",na.strings="-",fill=TRUE,header=T)
Friday, May 16, 2014
Using lumi, a package processing Illumina Microarray
### R code from vignette source 'vignettes/lumi/inst/doc/lumi.Rnw'
###################################################
### code chunk number 1: load library
###################################################
library(lumi)
###################################################
### code chunk number 2: load example data
###################################################
## load example data (a LumiBatch object)
data(example.lumi)
## summary of the example data
example.lumi
###################################################
### code chunk number 3: summary of example data
###################################################
## summary of the quality control
summary(example.lumi, 'QC')
###################################################
### code chunk number 4: densityPlot
###################################################
plot(example.lumi, what='density') ## plot the density
###################################################
### code chunk number 5: densityPlot
###################################################
plot(example.lumi, what='density') ## plot the density
###################################################
### code chunk number 6: CDF
###################################################
plotCDF(example.lumi)
###################################################
### code chunk number 7: pairPlot
###################################################
plot(example.lumi, what='pair') ## pairwise plots
###################################################
### code chunk number 8: lumi.Rnw:233-234
###################################################
plot(example.lumi, what='pair', smoothScatter=T)
###################################################
### code chunk number 9: MAplot
###################################################
## pairwise MAplot
plot(example.lumi, what='MAplot')
###################################################
### code chunk number 10: lumi.Rnw:265-267
###################################################
## pairwise MAplot
plot(example.lumi, what='MAplot', smoothScatter=T)
###################################################
### code chunk number 11: lumi.Rnw:279-281
###################################################
## density plot of coefficient of varience
plot(example.lumi, what='cv')
###################################################
### code chunk number 12: lumi.Rnw:292-293
###################################################
plot(example.lumi, what='sampleRelation')
###################################################
### code chunk number 13: lumi.Rnw:310-311
###################################################
plot(example.lumi, what='sampleRelation', method='mds', color=c("01", "02", "01", "02"))
###################################################
### code chunk number 14: VST transform
###################################################
## Do default VST variance stabilizing transform
lumi.T <- lumiT(example.lumi)
###################################################
### code chunk number 15: plotVST
###################################################
trans <- plotVST(lumi.T)
###################################################
### code chunk number 16: lumi.Rnw:356-358
###################################################
matplot(log2(trans$untransformed), trans$transformed, type='l', main='compare VST and log2 transform', xlab='log2 transformed', ylab='vST transformed')
abline(a=0, b=1, col=2)
###################################################
### code chunk number 17: Default normalization
###################################################
## Do quantile between microarray normaliazation
lumi.N <- lumiN(lumi.T)
###################################################
### code chunk number 18: Customized normalization (eval = FALSE)
###################################################
## ## Do RSN between microarray normaliazation
## lumi.N <- lumiN(lumi.T, method='rsn')
###################################################
### code chunk number 19: QC after normalization
###################################################
## Do quality control estimation after normalization
lumi.N.Q <- lumiQ(lumi.N)
## summary of the quality control
summary(lumi.N.Q, 'QC') ## summary of QC
###################################################
### code chunk number 20: lumi.Rnw:405-406
###################################################
plot(lumi.N.Q, what='density') ## plot the density
###################################################
### code chunk number 21: lumi.Rnw:415-417
###################################################
plot(lumi.N.Q, what='boxplot') ## box plot
# boxplot(lumi.N.Q)
###################################################
### code chunk number 22: lumi.Rnw:426-427
###################################################
plot(lumi.N.Q, what='pair') ## pairwise plots
###################################################
### code chunk number 23: lumi.Rnw:436-437
###################################################
plot(lumi.N.Q, what='MAplot') ## plot the pairwise MAplot
###################################################
### code chunk number 24: lumi.Rnw:446-448
###################################################
## plot the sampleRelation using hierarchical clustering
plot(lumi.N.Q, what='sampleRelation')
###################################################
### code chunk number 25: lumi.Rnw:457-459
###################################################
## plot the sampleRelation using MDS
plot(lumi.N.Q, what='sampleRelation', method='mds', color=c("01", "02", "01", "02"))
###################################################
### code chunk number 26: Encapsulate the processing steps
###################################################
## Do all the default preprocessing in one step
lumi.N.Q <- lumiExpresso(example.lumi)
###################################################
### code chunk number 27: lumi.Rnw:476-478
###################################################
## Do all the preprocessing with customized settings
# lumi.N.Q <- lumiExpresso(example.lumi, normalize.param=list(method='rsn'))
###################################################
### code chunk number 28: inverse VST
###################################################
## Parameters of VST transformed LumiBatch object
names(attributes(lumi.T))
## VST parameters: "vstParameter" and "transformFun"
attr(lumi.T, 'vstParameter')
attr(lumi.T, 'transformFun')
## Parameters of VST transformed and RSN normalized LumiBatch object
names(attributes(lumi.N.Q))
## VSN "targetArray" , VST parameters: "vstParameter" and "transformFun"
attr(lumi.N.Q, 'vstParameter')
attr(lumi.N.Q, 'transformFun')
## After doing statistical analysis of the data, users can recover to the raw scale for the fold-change estimation.
## Inverse VST to the raw scale
lumi.N.raw <- inverseVST(lumi.N.Q)
###################################################
### code chunk number 29: retrieve normalized data
###################################################
dataMatrix <- exprs(lumi.N.Q)
###################################################
### code chunk number 30: filtering
###################################################
presentCount <- detectionCall(example.lumi)
selDataMatrix <- dataMatrix[presentCount > 0,]
if (require(lumiHumanAll.db) & require(annotate)) {
selDataMatrix <- selDataMatrix[!is.na(getSYMBOL(rownames(selDataMatrix), 'lumiHumanAll.db')),]
}
probeList <- rownames(selDataMatrix)
###################################################
### code chunk number 31: Identify differentially expressed genes
###################################################
## Specify the sample type
sampleType <- c('100:0', '95:5', '100:0', '95:5')
if (require(limma)) {
## compare '95:5' and '100:0'
design <- model.matrix(~ factor(sampleType))
colnames(design) <- c('100:0', '95:5-100:0')
fit <- lmFit(selDataMatrix, design)
fit <- eBayes(fit)
## Add gene symbols to gene properties
if (require(illuminaHumanv4.db
) & require(annotate)) {
geneSymbol <- getSYMBOL(probeList, 'illuminaHumanv4.db
')
geneName <- sapply(lookUp(probeList, 'illuminaHumanv4.db
', 'GENENAME'), function(x) x[1])
fit$genes <- data.frame(ID= probeList, geneSymbol=geneSymbol, geneName=geneName, stringsAsFactors=FALSE)
}
## print the top 10 genes
print(topTable(fit, coef='95:5-100:0', adjust='fdr', number=10))
## get significant gene list with FDR adjusted p.values less than 0.01
p.adj <- p.adjust(fit$p.value[,2])
sigGene.adj <- probeList[ p.adj < 0.01]
## without FDR adjustment
sigGene <- probeList[ fit$p.value[,2] < 0.01]
}
###################################################
### code chunk number 32: GO analysis (eval = FALSE)
###################################################
## if (require(GOstats) & require(lumiHumanAll.db)) {
##
## ## Convert the probe Ids as Entrez Ids and make them unique
## sigLL <- unique(unlist(lookUp(sigGene,'lumiHumanAll.db','ENTREZID')))
## sigLL <- as.character(sigLL[!is.na(sigLL)])
## params <- new("GOHyperGParams",
## geneIds= sigLL,
## annotation="lumiHumanAll.db",
## ontology="BP",
## pvalueCutoff= 0.01,
## conditional=FALSE,
## testDirection="over")
##
## hgOver <- hyperGTest(params)
##
## ## Get the p-values of the test
## gGhyp.pv <- pvalues(hgOver)
##
## ## Adjust p-values for multiple test (FDR)
## gGhyp.fdr <- p.adjust(gGhyp.pv, 'fdr')
##
## ## select the Go terms with adjusted p-value less than 0.01
## sigGO.ID <- names(gGhyp.fdr[gGhyp.fdr < 0.01])
##
## ## Here only show the significant GO terms of BP (Molecular Function)
## ## For other categories, just follow the same procedure.
## sigGO.Term <- getGOTerm(sigGO.ID)[["BP"]]
## }
###################################################
### code chunk number 33: Create selected GO table (eval = FALSE)
###################################################
## if (require(GOstats) & require(lumiHumanAll.db) & require(xtable)) {
##
## ##get gene counts at each GO category
## gg.counts <- geneCounts(hgOver)[sigGO.ID]
## total.counts <- universeCounts(hgOver)[sigGO.ID]
##
## ggt <- unlist(sigGO.Term)
## numCh <- nchar(ggt)
## ggt2 <- substr(ggt, 1, 17)
## ggt3 <- paste(ggt2, ifelse(numCh > 17, "...", ""), sep="")
##
## ## output the significant GO categories as a table
## ggMat <- matrix(c(names(sigGO.Term), ggt3, signif(gGhyp.pv[sigGO.ID],5), gg.counts, total.counts),
## byrow=FALSE, nc=5, dimnames=list(1:length(sigGO.Term), c("GO ID",
## "Term", "p-value","Significant Genes No.", "Total Genes No.")))
## xtable.matrix(ggMat,
## caption="GO terms, p-values and counts.", label="ta:GOggterms")
## }
###################################################
### code chunk number 34: sessionInfo
###################################################
toLatex(sessionInfo())
biocLite("illuminaHumanv3.db")library("illuminaHumanv3.db")ids =c("ILMN_1762337","ILMN_2055271","ILMN_1736007","ILMN_2383229","ILMN_1806310")mget(ids, illuminaHumanv3GENOMICLOCATION)#$ILMN_1762337#[1] "chr7:20180663:20180712:-"##$ILMN_2055271#[1] "chr19:58856730:58856779:-"##$ILMN_1736007#[1] "chr19:58857369:58857418:-"##$ILMN_2383229#[1] "chr10:52566587:52566636:-"##$ILMN_1806310#[1] "chr10:52566496:52566545:-"mget(ids, illuminaHumanv3PROBESEQUENCE)#$ILMN_1762337#[1] "GTGTTACAAGACCTTCAGTCAGCTTTGGACAGAATGAAAAACCCTGTGAC"##$ILMN_2055271#[1] "GGGATTACAGGGGTGAGCCACCACGCCCAGCCCCAGCTTAGTTTTTTAAA"##$ILMN_1736007#[1] "GCAGAGCTGGACGCTGTGGAAATGGCTGGATTCCTCTGTGTTCTTTCCCA"##$ILMN_2383229#[1] "TGCTGTCCCTAATGCAACTGCACCCGTGTCTGCAGCCCAGCTCAAGCAAG"##$ILMN_1806310#[1] "GAGGTCTACCCAACTTTTGCAGTGACTGCCCGAGGGGATGGATATGGCAC"mget(ids, illuminaHumanv3GENENAME)#$ILMN_1762337#[1] "metastasis associated in colon cancer 1"##$ILMN_2055271#[1] NA##$ILMN_1736007#[1] NA##$ILMN_2383229#[1] "APOBEC1 complementation factor"##$ILMN_1806310#[1] "APOBEC1 complementation factor"
Subscribe to:
Posts (Atom)